| Gene name |
SPAC105.02c |
| Gene ID |
43/D12 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; hypothetical protein; ankyrin repeat
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
850 |
| ORF length (spliced) |
513 |
| Entry clone length |
850 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC105.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAACTGAAGGAGCTAA |
| Rev primer name |
SPAC105.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTTCATCCGACTCACCG |
| Amino acid length |
170 |
| Molecular weight |
18.5 |
| Isoelectric point (calc.) |
3.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LECLDWLLDI |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |