| Gene name |
SPBP4H10.20 |
| Gene ID |
43/H04 |
| Gene synonyms/obsolete |
nhm1; DcpS |
| Gene product |
eukaryotic conserved
protein; HIT family of pyrophosphatase; histidine triad (HIT)
motif protein; co-purifies with the cap-binding complex eIF4F;
RNA-binding protein; predicted novel decapping pathway;
putative scavenger mRNA decapping enzyme; homology to the
human tumour suppressor Fhit; possibly associates with
exonuclease exosome components |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1144 |
| ORF length (spliced) |
915 |
| Entry clone length |
1144 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBP4H10.20.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGAAAGTTCTGCCGC |
| Rev primer name |
SPBP4H10.20.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGCATTCATATTAGTTAAC |
| Amino acid length |
304 |
| Molecular weight |
35.1 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |