Gene name |
SPCC970.04c |
Gene ID |
44/B01 |
Gene synonyms/obsolete |
|
Gene product |
phosphoprotein;
involved in cell polarity; involved in cell cycle progression;
essential; involved in bipolar growth; interacts physically
with Orb6p |
Entry clone |
Cloned |
ORF length (unspliced) |
1256 |
ORF length (spliced) |
735 |
Entry clone length |
1256 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC970.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCTGTTAAATTCATT |
Rev primer name |
SPCC970.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATATTTCCTTGATTTTCT |
Amino acid length |
244 |
Molecular weight |
28.1 |
Isoelectric point (calc.) |
9.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |