| Gene name |
SPBC1A4.06c |
| Gene ID |
44/B06 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved eukaryotic
protein; similar to proline transport helper protein |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1278 |
| ORF length (spliced) |
1152 |
| Entry clone length |
1278 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1256G:T/
1251G:deletion/ 1235G:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1A4.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCTTTGGTAAAACCCA |
| Rev primer name |
SPBC1A4.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTTCGCATAGACATATAC |
| Amino acid length |
383 |
| Molecular weight |
44.3 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPLNLVKILGL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |