| Gene name |
SPAC23C4.20c |
| Gene ID |
44/E10 |
| Gene synonyms/obsolete |
SPAC1A6.01c |
| Gene product |
zinc finger protein;
zf-C2HC5 type; similar to human thyroid receptor interacting
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1422 |
| ORF length (spliced) |
1368 |
| Entry clone length |
1422 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23C4.20.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAAATGGACGAAGGA |
| Rev primer name |
SPAC23C4.20.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAACATCGATGGCATGCCA |
| Amino acid length |
455 |
| Molecular weight |
50.9 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
DeltaVision |