| Gene name |
SPAC24C9.15c |
| Gene ID |
44/H02 |
| Gene synonyms/obsolete |
spn5; mde9;
meu28 |
| Gene product |
GTP-binding protein;
septin; meiotic expression upregulated; meiosis dependent
expression |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1522 |
| ORF length (spliced) |
1395 |
| Entry clone length |
1522 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
595T:deletion /
596T:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC24C9.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAGCTCAAATTTGTC |
| Rev primer name |
SPAC24C9.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTAAGATGCCTGCTTTT |
| Amino acid length |
464 |
| Molecular weight |
53.1 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |