| Gene name |
SPAC1D4.03c |
| Gene ID |
45/D11 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in
intracellular protein transport; involved in protein-vacuolar
targeting; Sc deletion hypersensitive to brefeldin A or
monensin, two drugs that affect intracellular transport; SAND
family protein |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1628 |
| ORF length (spliced) |
1542 |
| Entry clone length |
1628 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
#check |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1D4.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACCAACATCTGAGCA |
| Rev primer name |
SPAC1D4.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACGAAAGGTTTGTTTGT |
| Amino acid length |
513 |
| Molecular weight |
58 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNAISPLPL |
| Localization (YFP) |
periphery at site of
septum formation; nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |