Gene name |
SPCC1259.12c |
Gene ID |
45/E12 |
Gene synonyms/obsolete |
|
Gene product |
SPRY domain; CTLH
domain; similar to human ranbpm; involved in vacuolar import
and degradation |
Entry clone |
Cloned |
ORF length (unspliced) |
1695 |
ORF length (spliced) |
1461 |
Entry clone length |
1695 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1259.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAGTACACCAAAGAA |
Rev primer name |
SPCC1259.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTTTAAATAAAAAAAAA |
Amino acid length |
486 |
Molecular weight |
55.6 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRFLRFLQL |
Localization (YFP) |
ambiguous
structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |