Gene name |
SPCC1620.12c |
Gene ID |
45/H04 |
Gene synonyms/obsolete |
|
Gene product |
RabGAP domain; TBC
domain protein; GTPase activating protein of Rab-like GTPase;
similar to Sp SPAC26F1.09 (paralog) |
Entry clone |
Cloned# |
ORF length (unspliced) |
1788 |
ORF length (spliced) |
|
Entry clone length |
1788 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1620.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGGAAATTAGTTTAGA |
Rev primer name |
SPCC1620.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTCTAAACATCTCAGAG |
Amino acid length |
595 |
Molecular weight |
68.1 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LACCFADSLQL/LNAWVEDSLAL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus |
Microscope used for
observation |
DeltaVision |