| Gene name |
SPAC31A2.12 |
| Gene ID |
45/H06 |
| Gene synonyms/obsolete |
|
| Gene product |
PY motif protein;
involved in heavy metal resistance; similar to Sp SPCC584.15C
(paralog); possibly binds to ubiquitin-protein ligase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1791 |
| ORF length (spliced) |
|
| Entry clone length |
1791 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC31A2.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATTCTCTCAAGGAA |
| Rev primer name |
SPAC31A2.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTCTTCTTGAAAATCCA |
| Amino acid length |
596 |
| Molecular weight |
65.9 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVPLLKRLTI/LRAALPVVLMI/LIAGLTELAL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Confocal |