Gene name |
SPBC1778.06c |
Gene ID |
46/C02 |
Gene synonyms/obsolete |
fim1 |
Gene product |
fimbrin; calponin
homology (CH) domain; EF hand motifs; calcium binding protein;
involved in actin cytoskeletal organization; involved in cell
polarity; involved in cytokinesis; involved in contractile
ring assembly; actin cortical patch component |
Entry clone |
Cloned |
ORF length (unspliced) |
1975 |
ORF length (spliced) |
1845 |
Entry clone length |
1975 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1778.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAGCTCTTAAACTTCA |
Rev primer name |
SPBC1778.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACGGCCATTAAACTGCCA |
Amino acid length |
614 |
Molecular weight |
68.6 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots at
site of septum formation and at periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |