| Gene name |
SPBC1778.06c |
| Gene ID |
46/C02 |
| Gene synonyms/obsolete |
fim1 |
| Gene product |
fimbrin; calponin
homology (CH) domain; EF hand motifs; calcium binding protein;
involved in actin cytoskeletal organization; involved in cell
polarity; involved in cytokinesis; involved in contractile
ring assembly; actin cortical patch component |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1975 |
| ORF length (spliced) |
1845 |
| Entry clone length |
1975 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1778.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAGCTCTTAAACTTCA |
| Rev primer name |
SPBC1778.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACGGCCATTAAACTGCCA |
| Amino acid length |
614 |
| Molecular weight |
68.6 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
site of septum formation and at periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |