Gene name |
SPBC31F10.11c |
Gene ID |
46/C09 |
Gene synonyms/obsolete |
cwf4; syf3 |
Gene product |
hypothetical protein;
involved in mRNA splicing; complexed with Cdc5p; 40S
snRNP-containing complex |
Entry clone |
Cloned |
ORF length (unspliced) |
2025 |
ORF length (spliced) |
|
Entry clone length |
2025 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC31F10.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCGGAAGCGCCCAG |
Rev primer name |
SPBC31F10.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGCCTCCAGCTTCTTTTTA |
Amino acid length |
674 |
Molecular weight |
80.8 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
624 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |