Gene name |
SPCC5E4.02c |
Gene ID |
46/E03 |
Gene synonyms/obsolete |
ccr4;
SPCC31H12.08c |
Gene product |
similar to yeast
glucose-repressible alcohol; CCR4-Not complex |
Entry clone |
Cloned |
ORF length (unspliced) |
2073 |
ORF length (spliced) |
|
Entry clone length |
2073 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC5E4.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTAATCCTAGGTATAC |
Rev primer name |
SPCC5E4.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTTTATCATTGTTAAAC |
Amino acid length |
690 |
Molecular weight |
76.4 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGTLFQLKI |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |