| Gene name |
SPBC1718.04 |
| Gene ID |
46/E05 |
| Gene synonyms/obsolete |
|
| Gene product |
phosphate
acyltransferase (SMART); involved in phospholipid
biosynthesis; SCT1 is a suppressor of a choline transport
mutant; similar to protein mutated in Barth syndrome |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2080 |
| ORF length (spliced) |
2028 |
| Entry clone length |
2080 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1718.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAACATACCTTTATTTA |
| Rev primer name |
SPBC1718.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCACTTAATTCTTCGTCA |
| Amino acid length |
675 |
| Molecular weight |
76.6 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |