Gene name |
SPAC19G12.07c |
Gene ID |
46/F08 |
Gene synonyms/obsolete |
|
Gene product |
involved in mRNA
splicing (implicated); no apparent Sc ortholog; rrm RNA
recognition motif; RNA-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2208 |
ORF length (spliced) |
1815 |
Entry clone length |
2208 |
No. of intron |
6 |
Sequence status |
Finished |
Sequence results |
667A:G / 1870T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC19G12.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGCTGGACGCGGAAGC |
Rev primer name |
SPAC19G12.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGTTTTGGCATTAGGG |
Amino acid length |
604 |
Molecular weight |
69.4 |
Isoelectric point (calc.) |
9.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
218/217 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |