| Gene name |
SPBC8E4.06 |
| Gene ID |
46/H02 |
| Gene synonyms/obsolete |
SPBC1289.16c |
| Gene product |
copper amine oxidase;
no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2385 |
| ORF length (spliced) |
|
| Entry clone length |
2385 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
978C:T / 1627G:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC8E4.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGAAGAAAGTAAAGC |
| Rev primer name |
SPBC8E4.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATACTTATGATATCTA |
| Amino acid length |
794 |
| Molecular weight |
90.1 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus, partially |
| Microscope used for
observation |
Leica |