Gene name |
SPAC19G12.01c |
Gene ID |
46/H03 |
Gene synonyms/obsolete |
cut20; lid1;
SPAPJ698.04c |
Gene product |
cyclosome/apc subunit;
Cut20/Apc4 anaphase-promoting complex (APC); cyclosome; WD
repeat protein (putative); involved in metaphase-anaphase
transition (regulation) |
Entry clone |
Cloned |
ORF length (unspliced) |
2386 |
ORF length (spliced) |
2160 |
Entry clone length |
2386 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC19G12.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGTCAAAATCTTTCAA |
Rev primer name |
SPAC19G12.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAAGAGAATAAACGATAT |
Amino acid length |
719 |
Molecular weight |
82.6 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?; nuclear dots;
nucleus>cytosol; periphery at site of septum
formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |