| Gene name |
SPCC162.07 |
| Gene ID |
46/H04 |
| Gene synonyms/obsolete |
|
| Gene product |
epsin; actin cortical
patch component; ENTH domain protein; involved in endocytosis;
involved in actin cytoskeletal organization; ubiquitin
interaction motif (2); target of Ark1/Prk1 family kinases
(potential) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2403 |
| ORF length (spliced) |
2121 |
| Entry clone length |
2403 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC162.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTTTCAGCGTTAGC |
| Rev primer name |
SPCC162.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAATCAATTAGAGAGCCA |
| Amino acid length |
706 |
| Molecular weight |
80.1 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
149/198 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |