Gene name |
SPBC211.02c |
Gene ID |
46/H05 |
Gene synonyms/obsolete |
cwf3; syf1 |
Gene product |
similarity to
drosophilla crooked neck protein; nineteen complex (Ntc)
(putative); involved in mRNA splicing; complexed with
Cdc5p |
Entry clone |
Cloned |
ORF length (unspliced) |
2431 |
ORF length (spliced) |
2373 |
Entry clone length |
2431 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC211.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAGATGTTATTCCACT |
Rev primer name |
SPBC211.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTTTCCTCACCAGTAATT |
Amino acid length |
790 |
Molecular weight |
92.6 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYDRVFELKI |
Localization (YFP) |
SPB; nuclear dots;
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |