Gene name |
SPAC144.06 |
Gene ID |
46/H12 |
Gene synonyms/obsolete |
apl5 |
Gene product |
AP-3 complex; adaptin;
clathrin-associated; involved in vesicle-mediated transport
|
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
2596 |
ORF length (spliced) |
2505 |
Entry clone length |
2596 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
Mixture |
Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC144.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGTTTGAAAGGACACT |
Rev primer name |
SPAC144.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACCTTTTTCTTTTTCTTT |
Amino acid length |
834 |
Molecular weight |
94.1 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
823 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSHFSTLGL/LKYIALLCL/LLMLLIILFL |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to: nucleus
(intranuclear microtubule bundle?) |
Microscope used for
observation |
DeltaVision |