| Gene name |
SPCC74.08c |
| Gene ID |
47/A02 |
| Gene synonyms/obsolete |
hmt1;
SPCC737.09c |
| Gene product |
ABC transporter
family; heavy metal ion transporter; ATP-binding cassette-type
vacuolar membrane transporter; involved in heavy metal
tolerance (required) |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
2615 |
| ORF length (spliced) |
2493 |
| Entry clone length |
2615 |
| No. of intron |
1 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC74.08c.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCTACGTTACAACAG |
| Rev primer name |
SPCC74.08c.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGAGTTTCAGCAGAAGTT |
| Amino acid length |
830 |
| Molecular weight |
93.9 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSLNFLNI |
| Localization (YFP) |
no expression
clone |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|