Gene name |
SPCC777.13 |
Gene ID |
47/A03 |
Gene synonyms/obsolete |
vps35 |
Gene product |
retromer complex;
involved in retrograde transport; involved in vesicle
formation from the prevacuole |
Entry clone |
Cloned |
ORF length (unspliced) |
2629 |
ORF length (spliced) |
2358 |
Entry clone length |
2629 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC777.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAAATTCTGCACTTAC |
Rev primer name |
SPCC777.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGAAAAATACTAGACCAA |
Amino acid length |
785 |
Molecular weight |
90.6 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDSVKFLVI/LKVLVGLNL/LQKSLCAILLL/LECLQKSLKI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |