| Gene name |
SPBC6B1.02 |
| Gene ID |
47/D02 |
| Gene synonyms/obsolete |
|
| Gene product |
Ark1/Prk1 family
protein kinase; serine/threonine protein kinase; similar to Sp
SPBC557.04 and SPCP1E11.02; actin cortical patch component;
consensus phosphorylation target site [LI]XXQXTG
(putative) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2862 |
| ORF length (spliced) |
|
| Entry clone length |
2862 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC6B1.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGAAGTCTACTCGAA |
| Rev primer name |
SPBC6B1.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCCAAGCTTTCAGATTTG |
| Amino acid length |
953 |
| Molecular weight |
105.8 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
815 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPHIERLNL |
| Localization (YFP) |
cytoplasmic dots with
filamentous structures |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |