Gene name |
SPCC70.01 |
Gene ID |
47/D07 |
Gene synonyms/obsolete |
SPCC1494.10 |
Gene product |
transcriptional
regulator; similar to N. crassa Som1; similar to Sp
SPBC1289.10c; LisH domain (SMART); single-stranded DNA binding
protein (SSDP) (inferred from context) |
Entry clone |
Cloned |
ORF length (unspliced) |
2895 |
ORF length (spliced) |
|
Entry clone length |
2895 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC70.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATTTCATGGACAT |
Rev primer name |
SPCC70.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAATAAACAGATGCCGAA |
Amino acid length |
964 |
Molecular weight |
104.5 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at site of
septum formation, contractile ring; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |