| Gene name |
SPBC18H10.01 |
| Gene ID |
47/E01 |
| Gene synonyms/obsolete |
SPBC11G11.07 |
| Gene product |
karyopherin-beta;
involved in nuclear protein import; involved in mRNA
export |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2919 |
| ORF length (spliced) |
2868 |
| Entry clone length |
2919 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC18H10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACGTTGTTAAGTGC |
| Rev primer name |
SPBC18H10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCATCAGAAATTAATTTT |
| Amino acid length |
955 |
| Molecular weight |
108.1 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
faint nuclear
envelope; nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |