Gene name |
SPBC947.04 |
Gene ID |
47/E03 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
glycoprotein; serine/threonine repeat; similar to Sp
SPBC1289.15 and SPBC21D10.06 and SPCC188.09C and SPAP11E10.02C
and SPBC21D10.06C and SPBC1348.08C and SPAC977.07C; possibly
Sp specific |
Entry clone |
Cloned |
ORF length (unspliced) |
2922 |
ORF length (spliced) |
|
Entry clone length |
2922 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
#check |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC947.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCTGTTTCCCCAAAT |
Rev primer name |
SPBC947.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAAGGCACAGCCTTAAAG |
Amino acid length |
973 |
Molecular weight |
100.8 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |