| Gene name |
SPBC685.01 |
| Gene ID |
47/G12 |
| Gene synonyms/obsolete |
pic1; SPBC336.15 |
| Gene product |
inner centromere
protein; involved in chromosome segregation; involved in
cytokinesis; serine-rich protein; interacts physically with
Ark1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3100 |
| ORF length (spliced) |
3057 |
| Entry clone length |
3100 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC685.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCTCTAATGGGTCAGA |
| Rev primer name |
SPBC685.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAAAACCCATGTTTTTC |
| Amino acid length |
1018 |
| Molecular weight |
114.4 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots; nucleus;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |