Gene name |
SPCC11E10.08 |
Gene ID |
47/H06 |
Gene synonyms/obsolete |
rik1 |
Gene product |
involved in chromatin
silencing; involved in chromatin silencing at silent mating
type cassettes (sensu Fungi) (required); similar to Sp
SPAC17H9.10C (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
3123 |
ORF length (spliced) |
|
Entry clone length |
3123 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC11E10.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTTATGTGTTCATTC |
Rev primer name |
SPCC11E10.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACATAAACTTTGTATTTCC |
Amino acid length |
1040 |
Molecular weight |
118.1 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVLLQALKI/LLVFESLFI/LGPIHDLLVL/LIYFQHALKL/LGGLKFLQL/LVPVNGRLIL |
Localization (YFP) |
SPB?; nucleus |
Comments for localization |
nuclear dots by over
expression; cytoplasmic dots by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |