Gene name |
SPAC3C7.08c |
Gene ID |
47/H10 |
Gene synonyms/obsolete |
elf1 |
Gene product |
AAA family ATPase;
involved in mRNA export; non-essential; interacts genetically
with rae1; interacts genetically with mex67; non-transporter
with ATP binding cassette |
Entry clone |
Cloned |
ORF length (unspliced) |
3174 |
ORF length (spliced) |
|
Entry clone length |
3174 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC3C7.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACATCCTCTGTGTTAAT |
Rev primer name |
SPAC3C7.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTTCATCATCAGAGAAG |
Amino acid length |
1057 |
Molecular weight |
116.7 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSRLKRLVL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
Leica |