| Gene name |
SPBC211.09 |
| Gene ID |
48/A09 |
| Gene synonyms/obsolete |
ptr3; uba1;
SPBC1604.21c |
| Gene product |
ubiquitin-activating
enzyme e1; involved in mRNA transport; poly(a)+ RNA transport
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3205 |
| ORF length (spliced) |
|
| Entry clone length |
3205 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2601A:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC211.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGTATGTAATTTGTT |
| Rev primer name |
SPBC211.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAACTTGATACAAATAAAT |
| Amino acid length |
1012 |
| Molecular weight |
112.9 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |