| Gene name |
SPAC29A4.19c |
| Gene ID |
48/C07 |
| Gene synonyms/obsolete |
|
| Gene product |
putative
calcium-transporting ATPase; P-type ATPase; P5 type; unknown
specificity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3433 |
| ORF length (spliced) |
3291 |
| Entry clone length |
3433 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC29A4.19.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCAATCGAATTAAA |
| Rev primer name |
SPAC29A4.19.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATGTTCAGAATACTCGTA |
| Amino acid length |
1096 |
| Molecular weight |
121.9 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTLGLLHLIL/LRFYLEPLNL/LLYFSNLDL/LRSLDVLTI/LSHGLLTLIL/LLSSLQYLGI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |