Gene name |
SPCC1223.06 |
Gene ID |
48/C11 |
Gene synonyms/obsolete |
tea1 |
Gene product |
tip elongation
aberrant microtubule-associated protein; involved in cell
polarity; involved in cellular elongation; kelch repeat
protein; target of Shk1p; phosphorylated by Shk1p; involved in
cytokinesis; involved in microtubule based movement; involved
in cell-end anchoring (required); similar to Sp tea3 |
Entry clone |
Cloned |
ORF length (unspliced) |
3444 |
ORF length (spliced) |
|
Entry clone length |
3444 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1223.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTTTATTTAAAAG |
Rev primer name |
SPCC1223.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTTCGTTGTCATGGACT |
Amino acid length |
1147 |
Molecular weight |
127.4 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |