| Gene name |
SPAC30.07c |
| Gene ID |
48/D02 |
| Gene synonyms/obsolete |
uso1;
SPAC29E6.03c |
| Gene product |
involved in
intracellular protein transport; involved in ER to Golgi
transport; armadillo repeat protein (inferred from context);
predicted coiled-coil region |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
3468 |
| ORF length (spliced) |
3135 |
| Entry clone length |
3468 |
| No. of intron |
3 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned/serious
mutation |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPAC30.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATTTTTCATAAAAG |
| Rev primer name |
SPAC30.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAGAACAAGGAGGAGCTG |
| Amino acid length |
1044 |
| Molecular weight |
119.1 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKVTLETCLIL/LTCLFDYLFL/LNIIQGYLDL/LQNCVGYLTL |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|