Gene name |
SPAC30D11.04c |
Gene ID |
48/D05 |
Gene synonyms/obsolete |
nup124 |
Gene product |
nuclear pore complex
|
Entry clone |
Cloned |
ORF length (unspliced) |
3523 |
ORF length (spliced) |
3480 |
Entry clone length |
3523 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC30D11.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCCTGTTTCAAAAAA |
Rev primer name |
SPAC30D11.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGTTTTCTTCGACTTCGG |
Amino acid length |
1159 |
Molecular weight |
123.9 |
Isoelectric point (calc.) |
10.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear envelope |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |