| Gene name |
SPBC609.01 |
| Gene ID |
48/E03 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
ribonuclease II (RNB ribonuclease II (RNB) family; similar to
Sp SPAC2C4.07c; similar to C. elegans f48e8.6; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3616 |
| ORF length (spliced) |
3474 |
| Entry clone length |
3616 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2191C:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC609.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCCTCATTGGAAAAG |
| Rev primer name |
SPBC609.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTGGATAGAGGACTTTGT |
| Amino acid length |
1157 |
| Molecular weight |
128.5 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTISIVVQLDL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |