| Gene name |
SPAC1565.07c |
| Gene ID |
48/E07 |
| Gene synonyms/obsolete |
|
| Gene product |
TATA binding protein
interacting protein; involved in transcriptional regulation;
no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3701 |
| ORF length (spliced) |
3663 |
| Entry clone length |
3701 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1565.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGAGGGAATTTTATT |
| Rev primer name |
SPAC1565.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTTTAATTGTAGTTTTG |
| Amino acid length |
1220 |
| Molecular weight |
137.8 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCVVCDSLEI/LTQKLLEVLGL/LSRLEYLPI/LSIVSELLNL/LLEHILGLLI/LKCLLIIPLSI/LSVFRFSLTL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |