| Gene name |
SPBC8E4.07c |
| Gene ID |
48/F02 |
| Gene synonyms/obsolete |
SPBC1289.15 |
| Gene product |
Sp specific families;
glucoprotein; repeat expansion; 26 copies of a 35 amino acid
repeat; possibly Sp specific |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3852 |
| ORF length (spliced) |
|
| Entry clone length |
3852 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2271A:G / 2689A:G /
2715G:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC8E4.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAGTGTTTACAGATCT |
| Rev primer name |
SPBC8E4.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAAACATTCCAACAATAG |
| Amino acid length |
1283 |
| Molecular weight |
129.5 |
| Isoelectric point (calc.) |
3.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSELKILGL |
| Localization (YFP) |
cytoplasmic
dots? |
| Comments for localization |
too dark to
photo |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |