| Gene name |
SPAC23D3.06c |
| Gene ID |
48/F08 |
| Gene synonyms/obsolete |
|
| Gene product |
nucleoporin; nuclear
pore complex; involved in nuclear export; involved in nuclear
import; involved in nuclear export of the small ribosomal
subunit |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4019 |
| ORF length (spliced) |
3978 |
| Entry clone length |
4019 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23D3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGCTGAAAATACTTT |
| Rev primer name |
SPAC23D3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCGGCCTTTTTCAGACTA |
| Amino acid length |
1325 |
| Molecular weight |
145.7 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVILRNLKL/LYLQFKNELDL |
| Localization (YFP) |
nucleus>cytosol;
nuclear envelope |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |