| Gene name |
SPAC9E9.12c |
| Gene ID |
48/G02 |
| Gene synonyms/obsolete |
abc1 |
| Gene product |
Abc1 transporter; ABC
transporter family; MDR subfamily; similar to mammalian bile
acid transporter |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4284 |
| ORF length (spliced) |
|
| Entry clone length |
4284 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2841G:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC9E9.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAATGTTTCAGTCTTT |
| Rev primer name |
SPAC9E9.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGACTAATATGACTTTCC |
| Amino acid length |
1427 |
| Molecular weight |
160.6 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
17 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSLTNLFL/LLEYIQIILSI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |