| Gene name |
SPAC23A1.17 |
| Gene ID |
48/G09 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
extensin-like; with SH adaptor protein; homolog of
Wiskott-Aldrich syndrome protein-interacting protein (WIP);
src (SH3) homology domain; actin cortical patch component;
possibly antagonistically regulate the type I myosins |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4836 |
| ORF length (spliced) |
|
| Entry clone length |
4836 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23A1.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTCGTTTCCCACAAG |
| Rev primer name |
SPAC23A1.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCCAACCAAGCCAAGAT |
| Amino acid length |
1611 |
| Molecular weight |
170.5 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNRAFSQRLNL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |