| Gene name |
SPBC19G7.05c |
| Gene ID |
48/H01 |
| Gene synonyms/obsolete |
cps1; drc1; bgs1 |
| Gene product |
1,3-beta-D-glucan
synthase subunit; glycosyl transferase family 48; involved in
septation; involved in cell polarity (maintenance); involved
in conjugation; involved in spore wall assembly; involved in
spore germination; involved in cell wall biosynthesis;
mutation confers hypersensitivity to cyclosporin A and
papulacandin B; regulator of DNA replication; phosphorylated
by CDK; similar to Sp SPCC1840.02c and SPAC24C9.07c and
SPAC19B12.03 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5190 |
| ORF length (spliced) |
|
| Entry clone length |
5190 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3026C:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC19G7.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCAGTATTGGCGTGA |
| Rev primer name |
SPBC19G7.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACAGAAGAATTCTTTGTT |
| Amino acid length |
1729 |
| Molecular weight |
199.6 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLISTLLL/LESYFFLTLNL/LLYLTDLSL/LFIAFFVLLIL |
| Localization (YFP) |
ambiguous
structure |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |