Gene name |
SPAC1486.05 |
Gene ID |
48/H04 |
Gene synonyms/obsolete |
nup189 |
Gene product |
nucleoporin; nuclear
pore complex; involved in nuclear import; involved in nuclear
export; involved in nuclear export of the small ribosomal
subunit; interacts physically with Ned1p (2-hybrid);
essential |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
5423 |
ORF length (spliced) |
5337 |
Entry clone length |
5423 |
No. of intron |
1 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1486.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGACAAAACAATTC |
Rev primer name |
SPAC1486.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATTGCACAGATATATTT |
Amino acid length |
1778 |
Molecular weight |
189.5 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNYRVVWQLAI/LWSLFVLLHL/LTDAICNLPL |
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|