| Gene name |
SPAP8A3.15c |
| Gene ID |
48/H07 |
| Gene synonyms/obsolete |
sec71; sec7a;
SPAC4D7.01c |
| Gene product |
Sec7 homolog; involved
in intracellular protein transport; similar to S. pombe
SPAC30.01C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5485 |
| ORF length (spliced) |
5436 |
| Entry clone length |
5485 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAP8A3.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGATTTGGAGATAGA |
| Rev primer name |
SPAP8A3.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAAGCATATCTTAAAAAT |
| Amino acid length |
1811 |
| Molecular weight |
206.9 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIRALCKLSI/LAAFSEPLQL/LLSIFSILSI/LHFLLPKALNL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |