| Gene name |
SPCC338.01c |
| Gene ID |
48/H12 |
| Gene synonyms/obsolete |
ags1; mok1;
SPCC17A7.01; SPCC1281.01 |
| Gene product |
a-1,3-glucan synthase;
alpha glucan synthase; glycosyl transferase family 1;
essential; involved in cell wall biosynthesis (required);
similar to Sp MOK11 and MOK12 and MOK13 and MOK14 |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
7233 |
| ORF length (spliced) |
|
| Entry clone length |
7233 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPCC338.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATGGTCTTCAAGGGTT |
| Rev primer name |
SPCC338.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGACGACTAAGGTTTTCA |
| Amino acid length |
2410 |
| Molecular weight |
272.1 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMHLSCLVI |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|