| Gene name |
SPAC12B10.11 |
| Gene ID |
49/B07 |
| Gene synonyms/obsolete |
exg2 |
| Gene product |
glycosyl hydrolase
family 5; exo-1,3-beta-d-glucanohydrolase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1713 |
| ORF length (spliced) |
|
| Entry clone length |
1713 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
66A:G / 468T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC12B10.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAATCTTTTAGAAGC |
| Rev primer name |
SPAC12B10.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATTCAGATTGCTCGTCA |
| Amino acid length |
570 |
| Molecular weight |
65.6 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCVFLSIILPL |
| Localization (YFP) |
ER? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |