| Gene name |
SPBC32H8.08c |
| Gene ID |
49/B08 |
| Gene synonyms/obsolete |
pi016;
SPACTOKYO_453.20 |
| Gene product |
mannosyltransferase
complex subunit predicted; glycosyl transferase family 15;
conserved fungal protein; similar to S. cerevisiae
YNL029C and YIL085C; similar to S. pombe SPBC1773.08C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1729 |
| ORF length (spliced) |
1317 |
| Entry clone length |
1729 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32H8.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTTATCTTACAGTA |
| Rev primer name |
SPBC32H8.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCATCTAAAAATCCCCCC |
| Amino acid length |
438 |
| Molecular weight |
51.9 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |