| Gene name |
SPCPJ732.01 |
| Gene ID |
49/B09 |
| Gene synonyms/obsolete |
vps5 |
| Gene product |
retromer complex;
involved in intracellular protein transport; PX domain;
phosphoinositide binding; involved in retrograde
transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1731 |
| ORF length (spliced) |
|
| Entry clone length |
1731 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
776A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCPJ732.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTGGGCATAATATATA |
| Rev primer name |
SPCPJ732.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGATCCAAAAATGATTCC |
| Amino acid length |
576 |
| Molecular weight |
64.2 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKSVYHALLL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
occasionally
cytoplasmic dots by over expression |
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol; cytoplasmic dots |
| Microscope used for
observation |
Leica |