Gene name |
SPAC12B10.12c |
Gene ID |
49/C12 |
Gene synonyms/obsolete |
rhp41; rhp4a |
Gene product |
involved in DNA
repair; involved in nucleotide-excision repair; XP-C family;
repairosome; similar to Sp rhp42 (paralog) |
Entry clone |
Cloned#/2004.10 &
Cloned#/ 3' FS |
ORF length (unspliced) |
1917 |
ORF length (spliced) |
|
Entry clone length |
1917 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC12B10.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGAGTGACGAAGATAA |
Rev primer name |
SPAC12B10.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACCGTATTCTTCGAATACA |
Amino acid length |
638 |
Molecular weight |
73.5 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
266 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWKRLITGLRI |
Localization (YFP) |
nucleus; spindle
microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |