Gene name |
SPAPB1A10.09 |
Gene ID |
49/D11 |
Gene synonyms/obsolete |
|
Gene product |
microtubule-associated
protein; involved in spindle elongation (anaphase); similar to
human prc1, protein regulating cytokinesis |
Entry clone |
Cloned |
ORF length (unspliced) |
2243 |
ORF length (spliced) |
2196 |
Entry clone length |
2243 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1203T:C /
1547T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB1A10.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACAGTAATGATGGA |
Rev primer name |
SPAPB1A10.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGCCTTCTTCTCCCCAT |
Amino acid length |
731 |
Molecular weight |
83.1 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPKVQSLLI |
Localization (YFP) |
microtubules |
Comments for localization |
only spindle
microtubules? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |