| Gene name |
SPAPB1E7.06c |
| Gene ID |
49/E04 |
| Gene synonyms/obsolete |
eme1 |
| Gene product |
hypothetical protein;
sequence orphan; contain endodeoxyribonuclease RUS activity;
Holliday junction resolvase; involved in DNA repair; involved
in nucleotide-excision repair; involved in DNA damage
recognition; predicted coiled-coil region; involved in meiotic
recombination (required) (late step); involved in the
processing of stalled and collapsed replication forks;
predicted coiled-coil region |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
2348 |
| ORF length (spliced) |
2217 |
| Entry clone length |
2348 |
| No. of intron |
2 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPB1E7.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTCTGCAGTCTACAGA |
| Rev primer name |
SPAPB1E7.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGTGCATCACTGGATGCT |
| Amino acid length |
738 |
| Molecular weight |
82.9 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
389/367 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSLNKLSI |
| Localization (YFP) |
no expression
clone |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|